Sequence retrieval

Genome: Kangiella koreensis DSM 16069
Start position: 1496539
End position: 1496586
Length: 48

DNA sequence
>NC_013166, from 1496539 to 1496586 (48 bp); Kangiella koreensis DSM 16069 ATTATTTGCGCAATTATTCGCGTAACTATTTACGCAATTCTTTGCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1496565-1498223	Sequence	Kkor_1399 - AMP-dependent synthetase and ligase (Protein is coded in complementary strand; from 1498223 to 1496565)