Sequence retrieval

Genome: Kangiella koreensis DSM 16069
Start position: 2594760
End position: 2594795
Length: 36

DNA sequence
>NC_013166, from 2594760 to 2594795 (36 bp); Kangiella koreensis DSM 16069 CCAAAAATATCACCAAAAACATCGCCAAAGATGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2593941-2595068	Sequence	Kkor_2395 - chaperone protein DnaJ (Protein is coded in complementary strand; from 2595068 to 2593941)