Sequence retrieval

Genome: Kangiella koreensis DSM 16069
Start position: 635709
End position: 635732
Length: 24

DNA sequence
>NC_013166, from 635709 to 635732 (24 bp); Kangiella koreensis DSM 16069 CTGCTTCCGCTTCTGCTTCAGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 635636-636325	Sequence	Kkor_0625 - ribosomal 5S rRNA E-loop-binding protein Ctc/L25/TL5 (Protein is coded in complementary strand; from 636325 to 635636)