Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 1551966
End position: 1551989
Length: 24

DNA sequence
>NC_013315, from 1551966 to 1551989 (24 bp); Clostridium difficile CD196 ATTTTTTTATTATTTTATTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1551302-1552393	Sequence	CD196_1333 - hypothetical protein (Protein is coded in complementary strand; from 1552393 to 1551302)