Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 1631060
End position: 1631089
Length: 30

DNA sequence
>NC_013315, from 1631060 to 1631089 (30 bp); Clostridium difficile CD196 TTTGTAATATTTTTGAATATTTTCTAATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1630425-1631099	Sequence	CD196_1400 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 1631099 to 1630425)