Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 2231574
End position: 2231597
Length: 24

DNA sequence
>NC_013315, from 2231574 to 2231597 (24 bp); Clostridium difficile CD196 TTATCTATATCTTTTTCTTTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2231439-2232248	Sequence	CD196_1938 pucC1 FAD-binding subunit of xanthine dehydrogenase (Protein is coded in complementary strand; from 2232248 to 2231439)