Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 2270891
End position: 2270926
Length: 36

DNA sequence
>NC_013315, from 2270891 to 2270926 (36 bp); Clostridium difficile CD196 TAATTTTCTCATTTATTTTCTCCTAAATTTTTTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2269821-2270903	Sequence	CD196_1967 - ABC transporter permease (Protein is coded in complementary strand; from 2270903 to 2269821)