Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 2417287
End position: 2417310
Length: 24

DNA sequence
>NC_013315, from 2417287 to 2417310 (24 bp); Clostridium difficile CD196 AAATATATAAATATAGAAATAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2415346-2417367	Sequence	CD196_2085 - hypothetical protein (Protein is coded in complementary strand; from 2417367 to 2415346)