Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 2563514
End position: 2563537
Length: 24

DNA sequence
>NC_013315, from 2563514 to 2563537 (24 bp); Clostridium difficile CD196 GCTTTTGCTTCTTCTTTTTCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2562530-2563621	Sequence	CD196_2206 - sulfonate ABC transporter solute-binding lipoprotein (Protein is coded in complementary strand; from 2563621 to 2562530)