Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 2598814
End position: 2598849
Length: 36

DNA sequence
>NC_013315, from 2598814 to 2598849 (36 bp); Clostridium difficile CD196 TTCTTATTGTTACTCTTATTTTTATTATTATTGTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2598376-2599044	Sequence	CD196_2238 - hypothetical protein (Protein is coded in complementary strand; from 2599044 to 2598376)