Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 2685955
End position: 2685978
Length: 24

DNA sequence
>NC_013315, from 2685955 to 2685978 (24 bp); Clostridium difficile CD196 TTATTTTTATTATTCTTTTTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2685112-2686131	Sequence	CD196_2315 spoIIP stage II sporulation protein P (Protein is coded in complementary strand; from 2686131 to 2685112)