Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 2712683
End position: 2712712
Length: 30

DNA sequence
>NC_013315, from 2712683 to 2712712 (30 bp); Clostridium difficile CD196 TTTATTGTATTTTCTTTTAATTTATTGTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2712140-2714023	Sequence	CD196_2339 selB selenocysteine-specific elongation factor (Protein is coded in complementary strand; from 2714023 to 2712140)