Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 2771586
End position: 2771615
Length: 30

DNA sequence
>NC_013315, from 2771586 to 2771615 (30 bp); Clostridium difficile CD196 ATTCTATTTTCTTCTAATTTATTCTTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2770626-2772932	Sequence	CD196_2385 - cellulose synthase catalytic subunit (Protein is coded in complementary strand; from 2772932 to 2770626)