Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 2865578
End position: 2865601
Length: 24

DNA sequence
>NC_013315, from 2865578 to 2865601 (24 bp); Clostridium difficile CD196 TATTTTTATTTGTATCTTGATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2865391-2867331	Sequence	CD196_2465 - hypothetical protein (Protein is coded in complementary strand; from 2867331 to 2865391)