Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 2891435
End position: 2891459
Length: 25

DNA sequence
>NC_013315, from 2891435 to 2891459 (25 bp); Clostridium difficile CD196 TTTTTTATTTCTTTTTTTGTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2890916-2891590	Sequence	CD196_2489 - hypothetical protein (Protein is coded in complementary strand; from 2891590 to 2890916)