Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 3074406
End position: 3074429
Length: 24

DNA sequence
>NC_013315, from 3074406 to 3074429 (24 bp); Clostridium difficile CD196 TTTATCTTCATCTTTATCTGTATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3074095-3075930	Sequence	CD196_2631 cwp66 cell surface protein (Protein is coded in complementary strand; from 3075930 to 3074095)