Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 3094850
End position: 3094873
Length: 24

DNA sequence
>NC_013315, from 3094850 to 3094873 (24 bp); Clostridium difficile CD196 ATTTTTATTTTCATCTTTATTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3090012-3095975	Sequence	CD196_2639 - hypothetical protein (Protein is coded in complementary strand; from 3095975 to 3090012)