Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 3219179
End position: 3219203
Length: 25

DNA sequence
>NC_013315, from 3219179 to 3219203 (25 bp); Clostridium difficile CD196 TTTTTTTATTTGTTTTTTATTGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3218106-3219227	Sequence	CD196_2739 - ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 3219227 to 3218106)