Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 3220400
End position: 3220423
Length: 24

DNA sequence
>NC_013315, from 3220400 to 3220423 (24 bp); Clostridium difficile CD196 TTACCTTTACCAATACCTTTATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3220106-3221479	Sequence	CD196_2741 ntpB V-type ATP synthase subunit B (Protein is coded in complementary strand; from 3221479 to 3220106)