Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 3298123
End position: 3298147
Length: 25

DNA sequence
>NC_013315, from 3298123 to 3298147 (25 bp); Clostridium difficile CD196 TTCTTTTGTTTTCATTTGTTTTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3297671-3298138	Sequence	CD196_2807 - hypothetical protein (Protein is coded in complementary strand; from 3298138 to 3297671)