Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 3376812
End position: 3376835
Length: 24

DNA sequence
>NC_013315, from 3376812 to 3376835 (24 bp); Clostridium difficile CD196 TTATAATTAAAATTACAAATATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3376238-3376855	Sequence	CD196_2870 - hypothetical protein (Protein is coded in complementary strand; from 3376855 to 3376238)