Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 3448556
End position: 3448609
Length: 54

DNA sequence
>NC_013315, from 3448556 to 3448609 (54 bp); Clostridium difficile CD196 TTCTTATTTAATACAAATTTCTTATTTAACATAGATTTCTTGTTTAATATAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3448600-3450027	Sequence	CD196_2921 ascB2 6-phospho-beta-glucosidase (Protein is coded in complementary strand; from 3450027 to 3448600)