Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 3499059
End position: 3499082
Length: 24

DNA sequence
>NC_013315, from 3499059 to 3499082 (24 bp); Clostridium difficile CD196 ATAATTATCATTATATTTAAAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3498442-3499569	Sequence	CD196_2952 - hypothetical protein (Protein is coded in complementary strand; from 3499569 to 3498442)