Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 3609301
End position: 3609327
Length: 27

DNA sequence
>NC_013315, from 3609301 to 3609327 (27 bp); Clostridium difficile CD196 GTTGGACCTGTTGGACCTATTGGACCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3608671-3610311	Sequence	CD196_3044 bclA2 exosporium glycoprotein (Protein is coded in complementary strand; from 3610311 to 3608671)