Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 3623885
End position: 3623920
Length: 36

DNA sequence
>NC_013315, from 3623885 to 3623920 (36 bp); Clostridium difficile CD196 GCTGCTTCTTCTACTGTTTCTTCTACTACTTCTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3622307-3624187	Sequence	CD196_3057 prdA proline reductase subunit proprotein (Protein is coded in complementary strand; from 3624187 to 3622307)