Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 3665526
End position: 3665549
Length: 24

DNA sequence
>NC_013315, from 3665526 to 3665549 (24 bp); Clostridium difficile CD196 TACTGCTACTGGCACTGCCACTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3665041-3665832	Sequence	CD196_3092 - PTS system transporter subunit IIC (Protein is coded in complementary strand; from 3665832 to 3665041)