Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 3730147
End position: 3730176
Length: 30

DNA sequence
>NC_013315, from 3730147 to 3730176 (30 bp); Clostridium difficile CD196 TTTATTCATTCCTATTCATTCCTATTCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3730159-3730743	Sequence	CD196_3149 clpP2 ATP-dependent Clp protease proteolytic subunit (Protein is coded in complementary strand; from 3730743 to 3730159)