Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 3798298
End position: 3798330
Length: 33

DNA sequence
>NC_013315, from 3798298 to 3798330 (33 bp); Clostridium difficile CD196 TAATTTTTTTATTATTTCTTTAAAATTTTTATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3798146-3799624	Sequence	CD196_3198 cbiK sirohydrochlorin cobaltochelatase (Protein is coded in complementary strand; from 3799624 to 3798146)