Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 4015858
End position: 4015881
Length: 24

DNA sequence
>NC_013315, from 4015858 to 4015881 (24 bp); Clostridium difficile CD196 TAGCTATAGCAATAGATATAGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4015119-4016477	Sequence	CD196_3404 - multidrug resistance protein (Protein is coded in complementary strand; from 4016477 to 4015119)