Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 506138
End position: 506167
Length: 30

DNA sequence
>NC_013315, from 506138 to 506167 (30 bp); Clostridium difficile CD196 TACTTATATTTAATTTTATTTACTGATAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 505979-506236	Sequence	CD196_0432 - hypothetical protein (Protein is coded in complementary strand; from 506236 to 505979)