Sequence retrieval

Genome: Clostridium difficile CD196
Start position: 532130
End position: 532153
Length: 24

DNA sequence
>NC_013315, from 532130 to 532153 (24 bp); Clostridium difficile CD196 AACCTTAATCTTAATCTTATCCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 532077-533321	Sequence	CD196_0455 - D-alanyl-D-alanine carboxypeptidase (Protein is coded in complementary strand; from 533321 to 532077)