Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 103405
End position: 103428
Length: 24

DNA sequence
>NC_013410, from 103405 to 103428 (24 bp); Fibrobacter succinogenes subsp. succinogenes S85 GCCCAAGCGCCCAACCGCCCACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 103206-104498	Sequence	Fisuc_0098 - hypothetical protein (Protein is coded in complementary strand; from 104498 to 103206)