Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 1679475
End position: 1679498
Length: 24

DNA sequence
>NC_013410, from 1679475 to 1679498 (24 bp); Fibrobacter succinogenes subsp. succinogenes S85 ACGCAAACGCAGACGAAACCGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1678634-1679677	Sequence	Fisuc_1357 - Appr-1-p processing protein (Protein is coded in complementary strand; from 1679677 to 1678634)