Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 2700086
End position: 2700109
Length: 24

DNA sequence
>NC_013410, from 2700086 to 2700109 (24 bp); Fibrobacter succinogenes subsp. succinogenes S85 GTTTTTGTTCTTGTTTTTATTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2697672-2700119	Sequence	Fisuc_2188 - hypothetical protein (Protein is coded in complementary strand; from 2700119 to 2697672)