Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 3306538
End position: 3306561
Length: 24

DNA sequence
>NC_013410, from 3306538 to 3306561 (24 bp); Fibrobacter succinogenes subsp. succinogenes S85 TATGAATATCAATAGGAATATCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3306309-3307208	Sequence	Fisuc_2670 - peptidase (Protein is coded in complementary strand; from 3307208 to 3306309)