Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 3361121
End position: 3361144
Length: 24

DNA sequence
>NC_013410, from 3361121 to 3361144 (24 bp); Fibrobacter succinogenes subsp. succinogenes S85 GCCGAAGCCGAAGCTGAAGTCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3358818-3362372	Sequence	Fisuc_2720 - chromosome segregation protein SMC