Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 3445299
End position: 3445322
Length: 24

DNA sequence
>NC_013410, from 3445299 to 3445322 (24 bp); Fibrobacter succinogenes subsp. succinogenes S85 TCTTTTTCTCTTTCTTGTTCATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3443045-3445321	Sequence	Fisuc_2793 - metal dependent phosphohydrolase (Protein is coded in complementary strand; from 3445321 to 3443045)