Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 3682748
End position: 3682774
Length: 27

DNA sequence
>NC_013410, from 3682748 to 3682774 (27 bp); Fibrobacter succinogenes subsp. succinogenes S85 TTTCTTGATTTTCTTGGTTGTCTTGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3682746-3685124	Sequence	Fisuc_2988 - Lytic transglycosylase catalytic (Protein is coded in complementary strand; from 3685124 to 3682746)