Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 116114
End position: 116141
Length: 28

DNA sequence
>NC_013410, from 116114 to 116141 (28 bp); Fibrobacter succinogenes subsp. succinogenes S85 CTCTCGTCTCTCGTCTCTCGTCTCTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 114933-116150	Sequence	Fisuc_0109 - oligopeptide/dipeptide ABC transporter ATPase (Protein is coded in complementary strand; from 116150 to 114933)