Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 1748816
End position: 1748843
Length: 28

DNA sequence
>NC_013410, from 1748816 to 1748843 (28 bp); Fibrobacter succinogenes subsp. succinogenes S85 ACTAACCACCAACCACTAACCACTAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1748843-1749406	Sequence	Fisuc_1436 - hypothetical protein (Protein is coded in complementary strand; from 1749406 to 1748843)