Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 18053
End position: 18080
Length: 28

DNA sequence
>NC_013410, from 18053 to 18080 (28 bp); Fibrobacter succinogenes subsp. succinogenes S85 TAGACGAAAGACGAGAGACGAAAGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 17578-18114	Sequence	Fisuc_0014 - hypothetical protein (Protein is coded in complementary strand; from 18114 to 17578)