Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 2544269
End position: 2544296
Length: 28

DNA sequence
>NC_013410, from 2544269 to 2544296 (28 bp); Fibrobacter succinogenes subsp. succinogenes S85 TAGACGAAAGACGAGAGACGAAAGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2543107-2544330	Sequence	Fisuc_2059 - oxidoreductase domain-containing protein (Protein is coded in complementary strand; from 2544330 to 2543107)