Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 2658242
End position: 2658269
Length: 28

DNA sequence
>NC_013410, from 2658242 to 2658269 (28 bp); Fibrobacter succinogenes subsp. succinogenes S85 TACTTCCTACTTCCGACTTCCTACTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2657884-2659539	Sequence	Fisuc_2150 - hypothetical protein (Protein is coded in complementary strand; from 2659539 to 2657884)