Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 2691340
End position: 2691367
Length: 28

DNA sequence
>NC_013410, from 2691340 to 2691367 (28 bp); Fibrobacter succinogenes subsp. succinogenes S85 ATAGACGAGAGACGAAAGACGAGAGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2690551-2691342	Sequence	Fisuc_2180 - DNA repair protein RecO (Protein is coded in complementary strand; from 2691342 to 2690551)