Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 2722927
End position: 2722954
Length: 28

DNA sequence
>NC_013410, from 2722927 to 2722954 (28 bp); Fibrobacter succinogenes subsp. succinogenes S85 CTGCCTACTGTCTACTTCCTACTGCCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2722953-2724458	Sequence	Fisuc_2209 - radical SAM protein (Protein is coded in complementary strand; from 2724458 to 2722953)