Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 2744302
End position: 2744329
Length: 28

DNA sequence
>NC_013410, from 2744302 to 2744329 (28 bp); Fibrobacter succinogenes subsp. succinogenes S85 TCTTTCGTCTCTCGTCTCTCGTCTTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2741836-2745375	Sequence	Fisuc_2229 - hypothetical protein (Protein is coded in complementary strand; from 2745375 to 2741836)