Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 3045222
End position: 3045249
Length: 28

DNA sequence
>NC_013410, from 3045222 to 3045249 (28 bp); Fibrobacter succinogenes subsp. succinogenes S85 CTTCCTACTTCCGACTTCCTACTTCCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3044349-3046871	Sequence	Fisuc_2466 - ABC transporter (Protein is coded in complementary strand; from 3046871 to 3044349)