Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 3060159
End position: 3060186
Length: 28

DNA sequence
>NC_013410, from 3060159 to 3060186 (28 bp); Fibrobacter succinogenes subsp. succinogenes S85 TAGAATTTAGAACTTAGAATTTAGAAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3058303-3060162	Sequence	Fisuc_2478 - carbohydrate binding family 6