Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 3174388
End position: 3174415
Length: 28

DNA sequence
>NC_013410, from 3174388 to 3174415 (28 bp); Fibrobacter succinogenes subsp. succinogenes S85 CTCTCGTCTCTCGTCTCTCGTCTCTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3174353-3175132	Sequence	Fisuc_2573 - hypothetical protein