Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 3614984
End position: 3615011
Length: 28

DNA sequence
>NC_013410, from 3614984 to 3615011 (28 bp); Fibrobacter succinogenes subsp. succinogenes S85 CTTTCGTCTTTCGTCTCTCGTCTTTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3614327-3615028	Sequence	Fisuc_2930 - GrpE protein HSP-70 cofactor (Protein is coded in complementary strand; from 3615028 to 3614327)